Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing VC2551 gene

Properties
Regulog: Zur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio cholerae O1 biovar eltor str. N16961
Position: -50
Score: 5.14441
Sequence: GACTTGTTATATTATAACAAGCC
Locus tag: VC2551
Name: VC2551
Funciton: hypothetical protein
Locus tag: VC2552
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VC2553
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VC2554
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VC2555
Name: VC2555
Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555 -50 5.1 GACTTGTTATATTATAACAAGCC VC2551
Vibrio parahaemolyticus RIMD 2210633
Position: -43
Score: 5.26494
Sequence: TGAGTGTTATATTATAACACCCG
Locus tag: VP0303
Name: VC2551
Funciton: hypothetical protein
Locus tag: VP0302
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VP0301
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VP0300
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VP0299
Name: VC2555
Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555 -43 5.3 TGAGTGTTATATTATAACACCCG VP0303
© 2009-2020 RegPrecise