Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuC2 gene

Properties
Regulog: Zur - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas fluorescens Pf-5
Position: -50
Score: 5.08307
Sequence: GCATTGTTATAATATAACATGTG
Locus tag: PFL_6177
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
Locus tag: PFL_6178
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PFL_6179
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: PFL_6180
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: PFL_6181
Name: hisI2
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Locus tag: PFL_6182
Name: can
Funciton: Carbonic anhydrase (EC 4.2.1.1)
Locus tag: PFL_6183
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
folE2-znuC2-znuB2-znuA2-hisI2-can-pyrC2 -50 5.1 GCATTGTTATAATATAACATGTG PFL_6177
© 2009-2020 RegPrecise