Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hemB2 gene

Properties
Regulog: Zur - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas putida KT2440
Position: -3
Score: 5.2972
Sequence: TAGATGTTATGTTATAACACTTA
Locus tag: PP3321
Name: PP3321
Funciton: hypothetical protein
Locus tag: PP3322
Name: hemB2
Funciton: Porphobilinogen synthase (EC 4.2.1.24)
Locus tag: PP3323
Name: yciC3
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: PP3324
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
PP3321-hemB2-yciC3-folE2 -3 5.3 TAGATGTTATGTTATAACACTTA PP3321
© 2009-2020 RegPrecise