Orthologous regulated operons containing znuB gene

Properties
Regulog:	Zur - Moraxellaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 28 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -111 Score: 5.93125 Sequence: AGCATGTTATAATATAACAAAGT Locus tag: AB57_0184 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: AB57_0183 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: AB57_0182 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-111	5.9	AGCATGTTATAATATAACAAAGT	AB57_0184
Acinetobacter sp. ADP1
Position: -97 Score: 6.10945 Sequence: CTTGTGTTATATTATAACAAATT Locus tag: ACIAD0176 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: ACIAD0175 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: ACIAD0174 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-97	6.1	CTTGTGTTATATTATAACAAATT	ACIAD0176
Psychrobacter arcticum 273-4
Position: -187 Score: 6.76161 Sequence: ATTATGTTATACTATAACATAAT Locus tag: Psyc_2033 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Psyc_2034 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Psyc_2035 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-187	6.8	ATTATGTTATACTATAACATAAT	Psyc_2033
Psychrobacter sp. PRwf-1
Position: -408 Score: 5.80252 Sequence: GATATGTTATACTATAACTAATA Locus tag: PsycPRwf_0184 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PsycPRwf_0183 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PsycPRwf_0182 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-408	5.8	GATATGTTATACTATAACTAATA	PsycPRwf_0184