Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing modB gene

Properties
Regulog: ModE2 - Sphingomonadales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Novosphingobium aromaticivorans DSM 12444
Position: -53
Score: 5.11765
Sequence: ACTGTATACTTCGGAACATAGC
Locus tag: Saro_0212
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: Saro_0213
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: Saro_0214
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -53 5.1 ACTGTATACTTCGGAACATAGC Saro_0212
Sphingomonas wittichii RW1
Position: -54
Score: 5.15115
Sequence: GCCATATATTATGGGATATAGC
Locus tag: Swit_4418
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: Swit_4417
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: Swit_4416
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -54 5.2 GCCATATATTATGGGATATAGC Swit_4418