Orthologous regulated operons containing modC gene

Properties
Regulog:	ModE - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/beta

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -13 Score: 7.34801 Sequence: CGCTATTCAGTCGATGAATAGCG Locus tag: Aave_2028 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Aave_2027 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Aave_2026 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-13	7.3	CGCTATTCAGTCGATGAATAGCG	Aave_2028
Acidovorax sp. JS42
Position: -34 Score: 7.00141 Sequence: CGCTATTCATCAATGGAATAGCG Locus tag: Ajs_3124 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Ajs_3125 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Ajs_3126 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-34	7	CGCTATTCATCAATGGAATAGCG	Ajs_3124
Comamonas testosteroni KF-1
Position: -13 Score: 7.31235 Sequence: CGCTATTCAAACAATGAATAGCG Locus tag: CtesDRAFT_2992 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: CtesDRAFT_2993 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: CtesDRAFT_2994 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-13	7.3	CGCTATTCAAACAATGAATAGCG	CtesDRAFT_2992
Delftia acidovorans SPH-1
Position: 26 Score: 6.75665 Sequence: CGCTATTCACCAACGGAATAGCG Locus tag: Daci_1520 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Daci_1519 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Daci_1518 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	26	6.8	CGCTATTCACCAACGGAATAGCG	Daci_1520
Rhodoferax ferrireducens DSM 15236
Position: -90 Score: 6.45766 Sequence: CGCTATTCCTAATTAGAATAGCG Locus tag: Rfer_2858 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Rfer_2859 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Rfer_2860 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-90	6.5	CGCTATTCCTAATTAGAATAGCG	Rfer_2858
Verminephrobacter eiseniae EF01-2
Position: -44 Score: 7.37256 Sequence: CGCTATTCCTTCAATGAATAGCG Locus tag: Veis_2888 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Veis_2887 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Veis_2886 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-44	7.4	CGCTATTCCTTCAATGAATAGCG	Veis_2888