Orthologous regulated operons containing modC gene

Properties
Regulog:	ModE - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Moritella sp. PE36
Position: -75 Score: 5.72919 Sequence: ATCGATATATAGCTTACTATACAGCGCT Locus tag: PE36_17160 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: PE36_17165 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: PE36_17170 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC	-75	5.7	ATCGATATATAGCTTACTATACAGCGCT	PE36_17160

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --