Orthologous regulated operons containing modA gene
| Regulog: | ModE - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -56
Score: 5.91849 Sequence: AGCGCTATATTCTTAAGTATATATCGCT
Locus tag: AB57_1980
Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: AB57_1981
Name: modB Funciton: Molybdate ABC transporter, permease protein
Locus tag: AB57_1982
Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein |
||||
| modA-modB-modC | -56 | 5.9 | AGCGCTATATTCTTAAGTATATATCGCT | AB57_1980 |