Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing trpB gene

Properties
Regulog: TrpR - Moraxellaceae
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Psychrobacter sp. PRwf-1
Position: -130
Score: 4.80687
Sequence: CGTATCAGTGTACTAGAACA
Locus tag: PsycPRwf_1460
Name: trpB
Funciton: Tryptophan synthase beta chain like (EC 4.2.1.20)
trpB -130 4.8 CGTATCAGTGTACTAGAACA PsycPRwf_1460
© 2009-2020 RegPrecise