Orthologous regulated operons containing trpG gene
| Regulog: | TrpR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychrobacter arcticum 273-4 | ||||
|
Position: -70
Score: 5.0181 Sequence: TGTACTACTGTACTAGAATA
Locus tag: Psyc_1666
Name: trpR Funciton: Trp operon repressor
Locus tag: Psyc_1667
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: Psyc_1668
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
| trpR-trpE-trpG | -70 | 5 | TGTACTACTGTACTAGAATA | Psyc_1666 |
| Psychrobacter sp. PRwf-1 | ||||
|
Position: -48
Score: 5.0181 Sequence: TGTACTACTGTACTAGAATA
Locus tag: PsycPRwf_1155
Name: trpR Funciton: Trp operon repressor
Locus tag: PsycPRwf_1154
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: PsycPRwf_1153
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
| trpR-trpE-trpG | -48 | 5 | TGTACTACTGTACTAGAATA | PsycPRwf_1155 |