Orthologous regulated operons containing trpG gene
| Regulog: | TrpR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Marinomonas sp. MWYL1 | ||||
|
Position: -45
Score: 4.25739 Sequence: TGTACTAGTACATGAATACA
Locus tag: Mmwyl1_0659
Name: trpR Funciton: Trp operon repressor
Locus tag: Mmwyl1_0660
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: Mmwyl1_0661
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
| trpR-trpE-trpG | -45 | 4.3 | TGTACTAGTACATGAATACA | Mmwyl1_0659 |
| Reinekea sp. MED297 | ||||
|
Position: -19
Score: 4.50403 Sequence: TGTTATAGCATACTAGTACA
Locus tag: MED297_18498
Name: trpR Funciton: Trp operon repressor
Locus tag: MED297_18503
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: MED297_18508
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
| trpR-trpE-trpG | -19 | 4.5 | TGTTATAGCATACTAGTACA | MED297_18498 |