Orthologous regulated operons containing trpR gene
Regulog: | TrpR - Oceanospirillales/Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | TrpR |
Regulation mode: | repressor |
Biological process: | Tryptophan biosynthesis |
Effector: | Tryptophan |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Marinomonas sp. MWYL1 | ||||
Position: -45
Score: 4.25739 Sequence: TGTACTAGTACATGAATACA
Locus tag: Mmwyl1_0659
Name: trpR Funciton: Trp operon repressor
Locus tag: Mmwyl1_0660
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: Mmwyl1_0661
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
trpR-trpE-trpG | -45 | 4.3 | TGTACTAGTACATGAATACA | Mmwyl1_0659 |
Reinekea sp. MED297 | ||||
Position: -19
Score: 4.50403 Sequence: TGTTATAGCATACTAGTACA
Locus tag: MED297_18498
Name: trpR Funciton: Trp operon repressor
Locus tag: MED297_18503
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: MED297_18508
Name: trpG Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27) |
||||
trpR-trpE-trpG | -19 | 4.5 | TGTTATAGCATACTAGTACA | MED297_18498 |