Orthologous regulated operons containing phhA gene
| Regulog: | TyrR - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
|
Position: -146
Score: 5.36319 Sequence: TTGTCACAAATTATTTACAA
Locus tag: AHA_1883
Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: AHA_1884
Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
||||
| phhA-phhB | -146 | 5.4 | TTGTCACAAATTATTTACAA | AHA_1883 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||||
|
Position: -136
Score: 5.36319 Sequence: TTGTCACAAATTGTTTACAA
Locus tag: ASA_2420
Name: phhA Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: ASA_2419
Name: phhB Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96) |
||||
| phhA-phhB | -136 | 5.4 | TTGTCACAAATTGTTTACAA | ASA_2420 |