Orthologous regulated operons containing crr gene

Properties
Regulog:	NagC - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -228 Score: 6.11858 Sequence: TTATTTTTCGTTATAAAATAA Locus tag: AHA_3039 Name: ptsH Funciton: Phosphocarrier protein of PTS system Locus tag: AHA_3040 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: AHA_3041 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
ptsH-ptsI-crr	-228	6.1	TTATTTTTCGTTATAAAATAA	AHA_3039
Aeromonas salmonicida subsp. salmonicida A449
Position: -228 Score: 6.11858 Sequence: TTATTTTTCGTTATAAAATAA Locus tag: ASA_3060 Name: ptsH Funciton: Phosphocarrier protein of PTS system Locus tag: ASA_3061 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: ASA_3062 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
ptsH-ptsI-crr	-228	6.1	TTATTTTTCGTTATAAAATAA	ASA_3060
Moritella sp. PE36
Position: -87 Score: 5.95042 Sequence: TTATTTTACTCTGTAAAATTA Locus tag: PE36_18600 Name: ptsH Funciton: Phosphocarrier protein of PTS system Locus tag: PE36_18605 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: PE36_18610 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
ptsH-ptsI-crr	-87	6	TTATTTTACTCTGTAAAATTA	PE36_18600

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --