Orthologous regulated operons containing ptsH gene
Regulog: | NagC - Psychromonadaceae/Aeromonadales |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | N-acetylglucosamine utilization |
Effector: | N-acetylglucosamine-6-phosphate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||||
Position: -228
Score: 6.11858 Sequence: TTATTTTTCGTTATAAAATAA
Locus tag: AHA_3039
Name: ptsH Funciton: Phosphocarrier protein of PTS system
Locus tag: AHA_3040
Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: AHA_3041
Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69) |
||||
ptsH-ptsI-crr | -228 | 6.1 | TTATTTTTCGTTATAAAATAA | AHA_3039 |
Aeromonas salmonicida subsp. salmonicida A449 | ||||
Position: -228
Score: 6.11858 Sequence: TTATTTTTCGTTATAAAATAA
Locus tag: ASA_3060
Name: ptsH Funciton: Phosphocarrier protein of PTS system
Locus tag: ASA_3061
Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: ASA_3062
Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69) |
||||
ptsH-ptsI-crr | -228 | 6.1 | TTATTTTTCGTTATAAAATAA | ASA_3060 |
Moritella sp. PE36 | ||||
Position: -87
Score: 5.95042 Sequence: TTATTTTACTCTGTAAAATTA
Locus tag: PE36_18600
Name: ptsH Funciton: Phosphocarrier protein of PTS system
Locus tag: PE36_18605
Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: PE36_18610
Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69) |
||||
ptsH-ptsI-crr | -87 | 6 | TTATTTTACTCTGTAAAATTA | PE36_18600 |