Orthologous regulated operons containing znuA gene
Regulog: | NagC - Pasteurellales |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | N-acetylglucosamine utilization |
Effector: | N-acetylglucosamine-6-phosphate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Aggregatibacter aphrophilus NJ8700 | ||||
Position: -103
Score: 6.35113 Sequence: TTATTTTTCAAAATAAAAAAA
Locus tag: NT05HA_1414
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA |
||||
znuA | -103 | 6.4 | TTATTTTTCAAAATAAAAAAA | NT05HA_1414 |
Pasteurella multocida subsp. multocida str. Pm70 | ||||
Position: -96
Score: 6.23775 Sequence: TTATTTTTTAGTTAAAAAAAA
Locus tag: PM0926
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA |
||||
znuA | -96 | 6.2 | TTATTTTTTAGTTAAAAAAAA | PM0926 |