Orthologous regulated operons containing exbD gene
| Regulog: | NagC - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pasteurella multocida subsp. multocida str. Pm70 | ||||
|
Position: -33
Score: 5.57644 Sequence: TTATTTTGCGATACAAATTAA
Locus tag: PM1186
Name: exbB Funciton: Biopolymer transport protein ExbB
Locus tag: PM1187
Name: exbD Funciton: Biopolymer transport protein ExbD/TolR
Locus tag: PM1188
Name: tonB Funciton: Periplasmic binding protein TonB |
||||
| exbB-exbD-tonB | -33 | 5.6 | TTATTTTGCGATACAAATTAA | PM1186 |