Orthologous regulated operons containing ptsI gene

Properties
Regulog:	NagC - Pasteurellales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aggregatibacter aphrophilus NJ8700
Position: -84 Score: 5.58831 Sequence: TTATTTTAGTGTTTTAAATAA Locus tag: NT05HA_0617 Name: ptsH Funciton: Phosphocarrier protein of PTS system Locus tag: NT05HA_0618 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: NT05HA_0619 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
ptsH-ptsI-crr	-84	5.6	TTATTTTAGTGTTTTAAATAA	NT05HA_0617
Pasteurella multocida subsp. multocida str. Pm70
Position: -104 Score: 6.36271 Sequence: TTATTTTTTATCCAAAAATAA Locus tag: PM0898 Name: ptsH Funciton: Phosphocarrier protein of PTS system Locus tag: PM0897 Name: ptsI Funciton: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Locus tag: PM0896 Name: crr Funciton: PTS system, glucose-specific IIA component (EC 2.7.1.69)
ptsH-ptsI-crr	-104	6.4	TTATTTTTTATCCAAAAATAA	PM0898

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --