Orthologous regulated operons containing Dace_2067 gene

Properties
Regulog:	ModE - Desulfuromonadales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/delta

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfuromonas acetoxidans DSM 684
Position: -86 Score: 5.67411 Sequence: TTGCGTTGTATAGCGTGGCATATAGCGTAA Locus tag: Dace_2070 Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate Locus tag: Dace_2069 Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter Locus tag: Dace_2068 Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter Locus tag: Dace_2067 Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter
omp_mod-Dace2069-Dace_2068-Dace_2067	-86	5.7	TTGCGTTGTATAGCGTGGCATATAGCGTAA	Dace_2070
Pelobacter carbinolicus str. DSM 2380
Position: -107 Score: 5.26048 Sequence: GTTCGCTATATTCCGCGATTAACAACGTAT Locus tag: Pcar_2396 Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter Locus tag: Pcar_2395 Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter Locus tag: Pcar_2394 Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter
Dace2069-Dace_2068-Dace_2067	-107	5.3	GTTCGCTATATTCCGCGATTAACAACGTAT	Pcar_2396
Pelobacter propionicus DSM 2379
Position: -107 Score: 5.65357 Sequence: CATCGTTATTACTAATACTATATAACTACG Locus tag: Ppro_1541 Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate Locus tag: Ppro_1540 Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter Locus tag: Ppro_1539 Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter Locus tag: Ppro_1538 Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter
omp_mod-Dace2069-Dace_2068-Dace_2067	-107	5.7	CATCGTTATTACTAATACTATATAACTACG	Ppro_1541