Orthologous regulated operons containing Dace_2067 gene
| Regulog: | ModE - Desulfuromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfuromonas acetoxidans DSM 684 | ||||
|
Position: -86
Score: 5.67411 Sequence: TTGCGTTGTATAGCGTGGCATATAGCGTAA
Locus tag: Dace_2070
Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate
Locus tag: Dace_2069
Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Dace_2068
Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Dace_2067
Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter |
||||
| omp_mod-Dace2069-Dace_2068-Dace_2067 | -86 | 5.7 | TTGCGTTGTATAGCGTGGCATATAGCGTAA | Dace_2070 |
| Pelobacter carbinolicus str. DSM 2380 | ||||
|
Position: -107
Score: 5.26048 Sequence: GTTCGCTATATTCCGCGATTAACAACGTAT
Locus tag: Pcar_2396
Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Pcar_2395
Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Pcar_2394
Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter |
||||
| Dace2069-Dace_2068-Dace_2067 | -107 | 5.3 | GTTCGCTATATTCCGCGATTAACAACGTAT | Pcar_2396 |
| Pelobacter propionicus DSM 2379 | ||||
|
Position: -107
Score: 5.65357 Sequence: CATCGTTATTACTAATACTATATAACTACG
Locus tag: Ppro_1541
Name: omp_mod Funciton: predicted TonB-dependent outer memberane transporter for molybdate
Locus tag: Ppro_1540
Name: Dace2069 Funciton: Duplicated ATPase component Dace2069 of energizing module of predicted ECF transporter
Locus tag: Ppro_1539
Name: Dace_2068 Funciton: Transmembrane component Dace_2068 of energizing module of predicted ECF transporter
Locus tag: Ppro_1538
Name: Dace_2067 Funciton: Core component Dace_2067 of predicted ECF transporter |
||||
| omp_mod-Dace2069-Dace_2068-Dace_2067 | -107 | 5.7 | CATCGTTATTACTAATACTATATAACTACG | Ppro_1541 |