Orthologous regulated operons containing oglP gene

Properties
Regulog:	KdgR - Pasteurellales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 17 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -153 Score: 5.54167 Sequence: ATTCAAAACATAATTTCATTT Locus tag: Asuc_1923 Name: oglP Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit Locus tag: Asuc_1922 Name: oglQ Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit Locus tag: Asuc_1921 Name: oglM Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
oglP-oglQ-oglM	-153	5.5	ATTCAAAACATAATTTCATTT	Asuc_1923
Mannheimia succiniciproducens MBEL55E
Position: -155 Score: 6.12521 Sequence: AATTAAAATAATGTTTTATTT Locus tag: MS0698 Name: oglP Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit Locus tag: MS0697 Name: oglQ Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit Locus tag: MS0696 Name: oglM Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
oglP-oglQ-oglM	-155	6.1	AATTAAAATAATGTTTTATTT	MS0698

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --