Orthologous regulated operons containing cslA gene
| Regulog: | KdgR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -127
Score: 5.50465 Sequence: AATTGAAAAGGTGTTTTGAAA
Locus tag: VV21092
Name: ugl Funciton: Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain
Locus tag: VV21091
Name: VV21091 Funciton: Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase
Locus tag: VV21090
Name: cslA Funciton: Chondroitinase AC precursor (EC 4.2.2.5) |
||||
| ugl-VV21091-cslA | -127 | 5.5 | AATTGAAAAGGTGTTTTGAAA | VV21092 |