Orthologous regulated operons containing VV21091 gene

Properties
Regulog:	KdgR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 40 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio vulnificus CMCP6
Position: -127 Score: 5.50465 Sequence: AATTGAAAAGGTGTTTTGAAA Locus tag: VV21092 Name: ugl Funciton: Unsaturated glucuronyl hydrolase, protein containing a thioredoxin domain Locus tag: VV21091 Name: VV21091 Funciton: Putative 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase Locus tag: VV21090 Name: cslA Funciton: Chondroitinase AC precursor (EC 4.2.2.5)
ugl-VV21091-cslA	-127	5.5	AATTGAAAAGGTGTTTTGAAA	VV21092

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --