Orthologous regulated operons containing VV21109 gene

Properties
Regulog:	KdgR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 40 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio vulnificus CMCP6
Position: -115 Score: 5.3116 Sequence: TTTTAAAACATCTTTTTATTT Position: -68 Score: 5.64514 Sequence: TTTTGAAACATCATTTCAATA Locus tag: VV21108 Name: null Funciton: Putative sulfatase (EC 3.1.6.-) Locus tag: VV21109 Name: null Funciton: Arylsulfatase (EC 3.1.6.1)
VV21108-VV21109	-115	5.3	TTTTAAAACATCTTTTTATTT	VV21108
	-68	5.6	TTTTGAAACATCATTTCAATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --