Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing oglM gene

Properties
Regulog: KdgR - Vibrionales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor (activator)
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 40 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -124
Score: 5.3854
Sequence: TTTTGAAACGATGTATCAATA
Locus tag: PBPRB1731
Name: kduI
Funciton: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Locus tag: PBPRB1730
Name: oglP
Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
Locus tag: PBPRB1729
Name: oglQ
Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
Locus tag: PBPRB1728
Name: oglM
Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
kduI-oglP-oglQ-oglM -124 5.4 TTTTGAAACGATGTATCAATA PBPRB1731
Vibrio shilonii AK1
Position: -164
Score: 5.4894
Sequence: TTTTAAAACGCAGTTTCAAAA
Locus tag: VSAK1_02644
Name: kduI
Funciton: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17)
Locus tag: VSAK1_02649
Name: oglP
Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
Locus tag: VSAK1_02654
Name: oglQ
Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
Locus tag: VSAK1_02659
Name: oglM
Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
Locus tag: VSAK1_02664
Name: kdgR2
Funciton: Transcriptional regulator, IclR family
kduI-oglP-oglQ-oglM-kdgR2 -164 5.5 TTTTAAAACGCAGTTTCAAAA VSAK1_02644