Orthologous regulated operons containing oglQ gene

Properties
Regulog:	KdgR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 40 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -124 Score: 5.3854 Sequence: TTTTGAAACGATGTATCAATA Locus tag: PBPRB1731 Name: kduI Funciton: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) Locus tag: PBPRB1730 Name: oglP Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit Locus tag: PBPRB1729 Name: oglQ Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit Locus tag: PBPRB1728 Name: oglM Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
kduI-oglP-oglQ-oglM	-124	5.4	TTTTGAAACGATGTATCAATA	PBPRB1731
Vibrio shilonii AK1
Position: -164 Score: 5.4894 Sequence: TTTTAAAACGCAGTTTCAAAA Locus tag: VSAK1_02644 Name: kduI Funciton: 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC 5.3.1.17) Locus tag: VSAK1_02649 Name: oglP Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit Locus tag: VSAK1_02654 Name: oglQ Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit Locus tag: VSAK1_02659 Name: oglM Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit Locus tag: VSAK1_02664 Name: kdgR2 Funciton: Transcriptional regulator, IclR family
kduI-oglP-oglQ-oglM-kdgR2	-164	5.5	TTTTAAAACGCAGTTTCAAAA	VSAK1_02644

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --