Orthologous regulated operons containing VSAK1_20364 gene

Properties
Regulog:	KdgR - Vibrionales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor (activator)
Biological process:	Pectin and polygalacturonate utlization
Effector:	2-keto-3-deoxygluconate
Phylum:	Proteobacteria/gamma

Built upon 40 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio shilonii AK1
Position: -189 Score: 5.79489 Sequence: TATTAAAACGCCGTTTTAATA Locus tag: VSAK1_20364 Name: VSAK1_20364 Funciton: Heparinase II/III-like protein Locus tag: VSAK1_20369 Name: VSAK1_20369 Funciton: Heparinase II/III-like protein Locus tag: VSAK1_20374 Name: togX2 Funciton: predicted oligogalacturonate transporter
VSAK1_20364-VSAK1_20369-togX2	-189	5.8	TATTAAAACGCCGTTTTAATA	VSAK1_20364

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --