Orthologous regulated operons containing VSAK1_20364 gene
| Regulog: | KdgR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pectin and polygalacturonate utlization |
| Effector: | 2-keto-3-deoxygluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio shilonii AK1 | ||||
|
Position: -189
Score: 5.79489 Sequence: TATTAAAACGCCGTTTTAATA
Locus tag: VSAK1_20364
Name: VSAK1_20364 Funciton: Heparinase II/III-like protein
Locus tag: VSAK1_20369
Name: VSAK1_20369 Funciton: Heparinase II/III-like protein
Locus tag: VSAK1_20374
Name: togX2 Funciton: predicted oligogalacturonate transporter |
||||
| VSAK1_20364-VSAK1_20369-togX2 | -189 | 5.8 | TATTAAAACGCCGTTTTAATA | VSAK1_20364 |