Orthologous regulated operons containing hmp gene
| Regulog: | NsrR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: -84
Score: 4.10211 Sequence: ACCTCCAAAAAATGAGTATCT
Locus tag: ABO_2119
Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
||||
| hmp | -84 | 4.1 | ACCTCCAAAAAATGAGTATCT | ABO_2119 |