Orthologous regulated operons containing hmp gene
| Regulog: | NsrR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -49
Score: 6.68081 Sequence: AGATGTATTTTAAATACATCT
Locus tag: AB57_3535
Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Locus tag: AB57_3536
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR |
||||
| hmp-nsrR | -49 | 6.7 | AGATGTATTTTAAATACATCT | AB57_3535 |
| Acinetobacter sp. ADP1 | ||||
|
Position: -72
Score: 6.35056 Sequence: AGATGCATTGCAAATACATCT
Position: -47
Score: 5.41848 Sequence: AAATGTATTTTGAATATATCT
Locus tag: ACIAD3226
Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Locus tag: ACIAD3227
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR |
||||
| hmp-nsrR | -72 | 6.4 | AGATGCATTGCAAATACATCT | ACIAD3226 |
| -47 | 5.4 | AAATGTATTTTGAATATATCT | ||
| Psychrobacter sp. PRwf-1 | ||||
|
Position: -142
Score: 6.90889 Sequence: AGATTCATTTGAAATGAATCT
Locus tag: PsycPRwf_0670
Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
||||
| hmp | -142 | 6.9 | AGATTCATTTGAAATGAATCT | PsycPRwf_0670 |