Orthologous regulated operons containing nsrR gene
| Regulog: | NsrR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: -27
Score: 4.10211 Sequence: AGATACTCATTTTTTGGAGGT
Locus tag: ABO_2120
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR |
||||
| nsrR | -27 | 4.1 | AGATACTCATTTTTTGGAGGT | ABO_2120 |
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -50
Score: 5.4342 Sequence: AGATGCAAAATAAATGAATCT
Locus tag: CJA_1547
Name: DUF454 Funciton: Hypothetical protein DUF454
Locus tag: CJA_1548
Name: nnrS Funciton: NnrS protein involved in response to NO
Locus tag: CJA_1549
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR |
||||
| DUF454-nnrS-nsrR | -50 | 5.4 | AGATGCAAAATAAATGAATCT | CJA_1547 |
| Reinekea sp. MED297 | ||||
|
Position: -44
Score: 5.49759 Sequence: AGATGTATATTAAATGCATCT
Locus tag: MED297_07531
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
Locus tag: MED297_07536
Name: nnrS Funciton: NnrS protein involved in response to NO |
||||
| nsrR-nnrS | -44 | 5.5 | AGATGTATATTAAATGCATCT | MED297_07531 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -82
Score: 4.90917 Sequence: AGATGTAATATACATGCATCT
Position: -56
Score: 5.25764 Sequence: AGATGCATAATAAATGTATCT
Locus tag: Sde_0102
Name: nnrS Funciton: NnrS protein involved in response to NO
Locus tag: Sde_0101
Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR |
||||
| nnrS-nsrR | -82 | 4.9 | AGATGTAATATACATGCATCT | Sde_0102 |
| -56 | 5.3 | AGATGCATAATAAATGTATCT | ||