Orthologous regulated operons containing nnrS gene

Properties
Regulog:	NsrR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -50 Score: 5.4342 Sequence: AGATGCAAAATAAATGAATCT Locus tag: CJA_1547 Name: DUF454 Funciton: Hypothetical protein DUF454 Locus tag: CJA_1548 Name: nnrS Funciton: NnrS protein involved in response to NO Locus tag: CJA_1549 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
DUF454-nnrS-nsrR	-50	5.4	AGATGCAAAATAAATGAATCT	CJA_1547
Reinekea sp. MED297
Position: -44 Score: 5.49759 Sequence: AGATGTATATTAAATGCATCT Locus tag: MED297_07531 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR Locus tag: MED297_07536 Name: nnrS Funciton: NnrS protein involved in response to NO
nsrR-nnrS	-44	5.5	AGATGTATATTAAATGCATCT	MED297_07531
Saccharophagus degradans 2-40
Position: -82 Score: 4.90917 Sequence: AGATGTAATATACATGCATCT Position: -56 Score: 5.25764 Sequence: AGATGCATAATAAATGTATCT Locus tag: Sde_0102 Name: nnrS Funciton: NnrS protein involved in response to NO Locus tag: Sde_0101 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
nnrS-nsrR	-82	4.9	AGATGTAATATACATGCATCT	Sde_0102
	-56	5.3	AGATGCATAATAAATGTATCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --