Orthologous regulated operons containing znuA gene

Properties
Regulog:	Zur - Desulfuromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/delta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Geobacter sp. FRC-32
Position: -51 Score: 7.93219 Sequence: TAAAAAGAAATGATTTCTATTTA Locus tag: Geob_0042 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Geob_0043 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Geob_0044 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Geob_0045 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB	-51	7.9	TAAAAAGAAATGATTTCTATTTA	Geob_0042
Geobacter sp. M21
Position: -32 Score: 7.47762 Sequence: TAAAACGAAATCATTTCCATTTA Locus tag: GM21_3601 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: GM21_3600 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: GM21_3599 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: GM21_3598 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB	-32	7.5	TAAAACGAAATCATTTCCATTTA	GM21_3601
Geobacter sulfurreducens PCA
Position: -41 Score: 7.47762 Sequence: TAAATGGAAATGATTTCTGTTTA Locus tag: GSU2987 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: GSU2986 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: GSU2985 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: GSU2984 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB	-41	7.5	TAAATGGAAATGATTTCTGTTTA	GSU2987
Geobacter uraniumreducens Rf4
Position: -217 Score: 7.93219 Sequence: TAAAAAGAAATGATTTCTATTTA Locus tag: Gura_0045 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Gura_0046 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Gura_0047 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Gura_0048 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuA-znuC-znuB	-217	7.9	TAAAAAGAAATGATTTCTATTTA	Gura_0045