Orthologous regulated operons containing nsrR gene
| Regulog: | NsrR - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudoalteromonas haloplanktis TAC125 | ||||
|
Position: -132
Score: 5.41907 Sequence: ACATGCAAACAAAATGCATGT
Locus tag: PSHAa2419
Name: nsrR Funciton: Rrf2 family nitrosative stress transcriptional regulator, NO-sensitive |
||||
| nsrR | -132 | 5.4 | ACATGCAAACAAAATGCATGT | PSHAa2419 |