Orthologous regulated operons containing tyrP gene
| Regulog: | TyrR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||||
|
Position: -97
Score: 5.89377 Sequence: GTGTAATAATATGTTTACAG
Locus tag: APP7_0642
Name: tyrP Funciton: Tyrosine-specific transport protein
Locus tag: APP7_0643
Name: tyrP Funciton: Tyrosine-specific transport protein |
||||
| tyrP-tyrP | -97 | 5.9 | GTGTAATAATATGTTTACAG | APP7_0642 |
| Haemophilus parasuis SH0165 | ||||
|
Position: -174
Score: 5.16335 Sequence: TTGTAAAAGAAAGTTTACTA
Locus tag: HAPS_0526
Name: tyrP Funciton: Tyrosine-specific transport protein |
||||
| tyrP | -174 | 5.2 | TTGTAAAAGAAAGTTTACTA | HAPS_0526 |
| Haemophilus somnus 2336 | ||||
|
Position: -99
Score: 5.65725 Sequence: ATGTAAACATAATATTACAT
Position: -78
Score: 5.73058 Sequence: TTGTAAAAATAAAATTACAC
Locus tag: HSM_1247
Name: tyrP Funciton: Tyrosine-specific transport protein |
||||
| tyrP | -99 | 5.7 | ATGTAAACATAATATTACAT | HSM_1247 |
| -78 | 5.7 | TTGTAAAAATAAAATTACAC | ||
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -40
Score: 5.53246 Sequence: CCGTAAAAAAATAATTACAT
Locus tag: MS0977
Name: tyrP Funciton: Tyrosine-specific transport protein |
||||
| tyrP | -40 | 5.5 | CCGTAAAAAAATAATTACAT | MS0977 |
| Pasteurella multocida subsp. multocida str. Pm70 | ||||
|
Position: -101
Score: 4.70836 Sequence: CTGTAAAATAATAATAACAC
Position: -82
Score: 5.87135 Sequence: CTGTAAAAAAATGGTTACAT
Locus tag: PM0732
Name: tyrP Funciton: Tyrosine-specific transport protein |
||||
| tyrP | -101 | 4.7 | CTGTAAAATAATAATAACAC | PM0732 |
| -82 | 5.9 | CTGTAAAAAAATGGTTACAT | ||