Orthologous regulated operons containing mntA gene
| Regulog: | Zur - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium amycolatum SK46 | ||||
|
Position: -143
Score: 4.36576 Sequence: GGTTGAAAATGCTTGTCGTTA
Locus tag: CORAM0001_0534
Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein
Locus tag: CORAM0001_0535
Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein
Locus tag: CORAM0001_0536
Name: mntC Funciton: putative manganese ABC transporter, permease component
Locus tag: CORAM0001_0537
Name: mntD Funciton: putative manganese ABC transporter, permease component 2
Locus tag: CORAM0001_0538
Name: mntR Funciton: Manganese-dependent transcriptional regulator MntR |
||||
| mntA-mntB-mntC-mntD-mntR | -143 | 4.4 | GGTTGAAAATGCTTGTCGTTA | CORAM0001_0534 |
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -40
Score: 5.31441 Sequence: TATTGACAAAGAGTGCCATTA
Position: 4
Score: 5.26642 Sequence: TACTGAAAGACATTTTCAATA
Locus tag: cg0041
Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein
Locus tag: cg0040
Name: cg0040 Funciton: putative secreted protein |
||||
| mntA-cg0040 | -40 | 5.3 | TATTGACAAAGAGTGCCATTA | cg0041 |
| 4 | 5.3 | TACTGAAAGACATTTTCAATA | ||
| Corynebacterium urealyticum DSM 7109 | ||||
|
Position: -128
Score: 5.2542 Sequence: TAATGGAAAACAGTGCCATTA
Locus tag: cur_1147
Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein
Locus tag: cur_1146
Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein
Locus tag: cur_1145
Name: mntC Funciton: putative manganese ABC transporter, permease component
Locus tag: cur_1144
Name: mntD Funciton: putative manganese ABC transporter, permease component 2 |
||||
| mntA-mntB-mntC-mntD | -128 | 5.3 | TAATGGAAAACAGTGCCATTA | cur_1147 |