Orthologous regulated operons containing mntA gene

Properties
Regulog:	Zur - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria

Built upon 38 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium amycolatum SK46
Position: -143 Score: 4.36576 Sequence: GGTTGAAAATGCTTGTCGTTA Locus tag: CORAM0001_0534 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: CORAM0001_0535 Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein Locus tag: CORAM0001_0536 Name: mntC Funciton: putative manganese ABC transporter, permease component Locus tag: CORAM0001_0537 Name: mntD Funciton: putative manganese ABC transporter, permease component 2 Locus tag: CORAM0001_0538 Name: mntR Funciton: Manganese-dependent transcriptional regulator MntR
mntA-mntB-mntC-mntD-mntR	-143	4.4	GGTTGAAAATGCTTGTCGTTA	CORAM0001_0534
Corynebacterium glutamicum ATCC 13032
Position: -40 Score: 5.31441 Sequence: TATTGACAAAGAGTGCCATTA Position: 4 Score: 5.26642 Sequence: TACTGAAAGACATTTTCAATA Locus tag: cg0041 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: cg0040 Name: cg0040 Funciton: putative secreted protein
mntA-cg0040	-40	5.3	TATTGACAAAGAGTGCCATTA	cg0041
	4	5.3	TACTGAAAGACATTTTCAATA
Corynebacterium urealyticum DSM 7109
Position: -128 Score: 5.2542 Sequence: TAATGGAAAACAGTGCCATTA Locus tag: cur_1147 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: cur_1146 Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein Locus tag: cur_1145 Name: mntC Funciton: putative manganese ABC transporter, permease component Locus tag: cur_1144 Name: mntD Funciton: putative manganese ABC transporter, permease component 2
mntA-mntB-mntC-mntD	-128	5.3	TAATGGAAAACAGTGCCATTA	cur_1147