Orthologous regulated operons containing adhA gene
| Regulog: | Zur - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium diphtheriae NCTC 13129 | ||||
|
Position: -37
Score: 5.47802 Sequence: TATTGAAAATAGGTACCATTA
Locus tag: DIP2114
Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 ) |
||||
| adhA | -37 | 5.5 | TATTGAAAATAGGTACCATTA | DIP2114 |
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -317
Score: 5.69017 Sequence: AATTGAAAAACATTTCCATTA
Locus tag: cg3107
Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 ) |
||||
| adhA | -317 | 5.7 | AATTGAAAAACATTTCCATTA | cg3107 |
| Corynebacterium urealyticum DSM 7109 | ||||
|
Position: -98
Score: 4.7507 Sequence: TAATGGGAACTATACTCATTA
Locus tag: cur_1829
Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 ) |
||||
| adhA | -98 | 4.8 | TAATGGGAACTATACTCATTA | cur_1829 |