Orthologous regulated operons containing sapD gene
Regulog: | Zur - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Corynebacterium aurimucosum ATCC 700975 | ||||
Position: -116
Score: 4.44234 Sequence: AATTGAACCCTGTTTCCACTA
Position: -67
Score: 4.36061 Sequence: TAACGGGACTGAATTCCATTA
Locus tag: cauri_1146
Name: cmrA Funciton: hypothetical protein
Locus tag: cauri_1145
Name: sapD Funciton: putative surface-anchored protein
Locus tag: cauri_1144
Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA |
||||
cmrA-sapD-troA | -116 | 4.4 | AATTGAACCCTGTTTCCACTA | cauri_1146 |
-67 | 4.4 | TAACGGGACTGAATTCCATTA | ||
Corynebacterium diphtheriae NCTC 13129 | ||||
Position: -84
Score: 4.95415 Sequence: TATTGGTTATCTTTTTCATTT
Locus tag: DIP0442
Name: null Funciton: Putative membrane protein
Locus tag: DIP0443
Name: sapD Funciton: putative surface-anchored protein |
||||
DIP0442-sapD | -84 | 5 | TATTGGTTATCTTTTTCATTT | DIP0442 |
Corynebacterium jeikeium K411 | ||||
Position: -75
Score: 4.37991 Sequence: GTTTGAAAATGGTTGCCACTT
Position: -42
Score: 4.23974 Sequence: TAATGAAAACTAGACTCATTG
Locus tag: jk1856
Name: sapD Funciton: putative surface-anchored protein
Locus tag: jk1855
Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: jk1854
Name: DIP0439 Funciton: Putative membrane protein
Locus tag: jk1853
Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein
Locus tag: jk1852
Name: DIP0441 Funciton: putative ABC transport system, permease protein |
||||
sapD-troA-DIP0439-DIP0440-DIP0441 | -75 | 4.4 | GTTTGAAAATGGTTGCCACTT | jk1856 |
-42 | 4.2 | TAATGAAAACTAGACTCATTG | ||
Corynebacterium urealyticum DSM 7109 | ||||
Position: -160
Score: 5.05348 Sequence: AAAGGAAAACCATTGCCAATT
Position: -103
Score: 5.03567 Sequence: ACTTGAAAATGGCTGTCATTA
Locus tag: cur_0291
Name: sapD Funciton: putative surface-anchored protein
Locus tag: cur_0292
Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: cur_0293
Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein
Locus tag: cur_0294
Name: DIP0441 Funciton: putative ABC transport system, permease protein |
||||
sapD-troA-DIP0440-DIP0441 | -160 | 5.1 | AAAGGAAAACCATTGCCAATT | cur_0291 |
-103 | 5 | ACTTGAAAATGGCTGTCATTA |