Orthologous regulated operons containing znuC gene
| Regulog: | Zur - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium amycolatum SK46 | ||||
|
Position: -85
Score: 5.40811 Sequence: AAAGGACAACTGTTTTCAATA
Locus tag: CORAM0001_1250
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: CORAM0001_1251
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CORAM0001_1252
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -85 | 5.4 | AAAGGACAACTGTTTTCAATA | CORAM0001_1250 |
| Corynebacterium aurimucosum ATCC 700975 | ||||
|
Position: -39
Score: 5.08166 Sequence: ATTTGACAACAATTTTCACTA
Locus tag: cauri_2206
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: cauri_2207
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: cauri_2208
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -39 | 5.1 | ATTTGACAACAATTTTCACTA | cauri_2206 |
| Corynebacterium efficiens YS-314 | ||||
|
Position: 1
Score: 5.77025 Sequence: TGTTGACAATCGTTTCCAATA
Locus tag: CE2512
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: CE2513
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CE2514
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | 1 | 5.8 | TGTTGACAATCGTTTCCAATA | CE2512 |
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -38
Score: 5.43721 Sequence: TGTTGACATCCTTTTTCAATA
Locus tag: cg2911
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: cg2912
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: cg2913
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -38 | 5.4 | TGTTGACATCCTTTTTCAATA | cg2911 |
| Corynebacterium jeikeium K411 | ||||
|
Position: 40
Score: 4.99347 Sequence: TgAaGAAAATGgTTgcCAaTt
Locus tag: jk0328
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: jk0327
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: jk0326
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | 40 | 5 | TgAaGAAAATGgTTgcCAaTt | jk0328 |
| Corynebacterium kroppenstedtii DSM 44385 | ||||
|
Position: -38
Score: 5.05233 Sequence: AATTGACATCATATTTCATTA
Locus tag: ckrop_0347
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: ckrop_0346
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ckrop_0345
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -38 | 5.1 | AATTGACATCATATTTCATTA | ckrop_0347 |
| Corynebacterium urealyticum DSM 7109 | ||||
|
Position: -43
Score: 5.0514 Sequence: TATTGCAATCTGTTCCCATTA
Locus tag: cur_1662
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: cur_1663
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: cur_1664
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB |
||||
| znuA-znuC-znuB | -43 | 5.1 | TATTGCAATCTGTTCCCATTA | cur_1662 |