Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ABC_Zn_A gene

Properties
Regulog: Zur - Ralstonia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode:
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/beta
Built upon 19 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia eutropha H16
Position: -58
Score: 5.51211
Sequence: CAATTGCAATTGAGTTGCGTTAA
Locus tag: H16_B2121
Name: h16_B2121
Funciton: hypothetical protein
Locus tag: H16_B2120
Name: omr3
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: H16_B2119
Name: h16_B2119
Funciton: ABC-type transporter, ATPase component
Locus tag: H16_B2118
Name: h16_B2118
Funciton: hypothetical membrane spanning protein
Locus tag: H16_B2117
Name: h16_B2117
Funciton: ABC-type transporter, permease component
h16_B2121-omr3-h16_B2119-h16_B2118-h16_B2117 -58 5.5 CAATTGCAATTGAGTTGCGTTAA H16_B2121