Orthologous regulated operons containing h16_A0192 gene

Properties
Regulog:	Zur - Ralstonia
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/beta

Built upon 19 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -76 Score: 5.9023 Sequence: AATTCGCAACCTTGTTGCAACAG Locus tag: RALTA_A0136 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RALTA_A0135 Name: null Funciton: hypothetical transmembrane protein Locus tag: RALTA_A0134 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC-RALTA_A0135-omr	-76	5.9	AATTCGCAACCTTGTTGCAACAG	RALTA_A0136
Ralstonia eutropha H16
Position: -75 Score: 5.96793 Sequence: AATTCGCAACCTTGTTGCAACAA Locus tag: H16_A0193 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: H16_A0192 Name: h16_A0192 Funciton: hypothetical transmembrane protein Locus tag: H16_A0191 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC-h16_A0192-omr	-75	6	AATTCGCAACCTTGTTGCAACAA	H16_A0193
Ralstonia eutropha JMP134
Position: -66 Score: 6.31073 Sequence: CAGTCGCAACTTTGTTGCAATAA Locus tag: Reut_A0161 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Reut_A0160 Name: null Funciton: hypothetical transmembrane protein Locus tag: Reut_A0159 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC-Reut_A0160-omr	-66	6.3	CAGTCGCAACTTTGTTGCAATAA	Reut_A0161
Ralstonia metallidurans CH34
Position: -34 Score: 6.1063 Sequence: CAGTCGCAACTTTGTTGCATCAA Locus tag: Rmet_0125 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: Rmet_0124 Name: null Funciton: hypothetical transmembrane protein Locus tag: Rmet_0123 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
yciC-Rmet_0124-omr	-34	6.1	CAGTCGCAACTTTGTTGCATCAA	Rmet_0125
Ralstonia pickettii 12J
Position: -31 Score: 5.74979 Sequence: AATTCGCAACTTAGTTGCATTGG Locus tag: Rpic_0521 Name: null Funciton: hypothetical transmembrane protein Locus tag: Rpic_0522 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Rpic_0521-omr	-31	5.7	AATTCGCAACTTAGTTGCATTGG	Rpic_0521
Ralstonia solanacearum GMI1000
Position: -95 Score: 5.74979 Sequence: AATTCGCAACTTAGTTGCATTGG Locus tag: RS04852 Name: RSc0594 Funciton: hypothetical transmembrane protein Locus tag: RS04851 Name: omr Funciton: predicted zinc-related TonB-dependent outer membrane transporter
RSc0594-omr	-95	5.7	AATTCGCAACTTAGTTGCATTGG	RS04852