Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nnrS2 gene

Properties
Regulog: NsrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Built upon 51 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella denitrificans OS217
Position: -110
Score: 4.37171
Sequence: ACAatCATtaTAaATaCcTGT
Locus tag: Sden_2837
Name: nnrS2
Funciton: NnrS protein involved in response to NO
nnrS2 -110 4.4 ACAatCATtaTAaATaCcTGT Sden_2837
Shewanella frigidimarina NCIMB 400
Position: -64
Score: 5.56222
Sequence: AGATTTATATATTATGCATGT
Locus tag: Sfri_3037
Name: nnrS2
Funciton: NnrS protein involved in response to NO
Locus tag: Sfri_3036
Name: nrfA
Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA -64 5.6 AGATTTATATATTATGCATGT Sfri_3037
Shewanella pealeana ATCC 700345
Position: -35
Score: 4.75461
Sequence: AGCTGTATTTTAAATGCGTGT
Locus tag: Spea_1227
Name: nnrS2
Funciton: NnrS protein involved in response to NO
Locus tag: Spea_1228
Name: nrfA
Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA -35 4.8 AGCTGTATTTTAAATGCGTGT Spea_1227
Shewanella piezotolerans WP3
Position: -39
Score: 4.22593
Sequence: AggTaCATtaAAaATaCcTGT
Locus tag: swp_3404
Name: nnrS2
Funciton: NnrS protein involved in response to NO
Locus tag: swp_3403
Name: nrfA
Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA -39 4.2 AggTaCATtaAAaATaCcTGT swp_3404
Shewanella sp ANA-3
Position: -46
Score: 4.52546
Sequence: AAGTGCAATTATTATGAAGCT
Locus tag: Shewana3_2362
Name: nnrS2
Funciton: NnrS protein involved in response to NO
Locus tag: Shewana3_2363
Name: nrfA
Funciton: Nitrite reductase, cytochrome c(552)
nnrS2-nrfA -46 4.5 AAGTGCAATTATTATGAAGCT Shewana3_2362