Orthologous regulated operons containing nnrS2 gene
| Regulog: | NsrR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella denitrificans OS217 | ||||
|
Position: -110
Score: 4.37171 Sequence: ACAatCATtaTAaATaCcTGT
Locus tag: Sden_2837
Name: nnrS2 Funciton: NnrS protein involved in response to NO |
||||
| nnrS2 | -110 | 4.4 | ACAatCATtaTAaATaCcTGT | Sden_2837 |
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -64
Score: 5.56222 Sequence: AGATTTATATATTATGCATGT
Locus tag: Sfri_3037
Name: nnrS2 Funciton: NnrS protein involved in response to NO
Locus tag: Sfri_3036
Name: nrfA Funciton: Nitrite reductase, cytochrome c(552) |
||||
| nnrS2-nrfA | -64 | 5.6 | AGATTTATATATTATGCATGT | Sfri_3037 |
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -35
Score: 4.75461 Sequence: AGCTGTATTTTAAATGCGTGT
Locus tag: Spea_1227
Name: nnrS2 Funciton: NnrS protein involved in response to NO
Locus tag: Spea_1228
Name: nrfA Funciton: Nitrite reductase, cytochrome c(552) |
||||
| nnrS2-nrfA | -35 | 4.8 | AGCTGTATTTTAAATGCGTGT | Spea_1227 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -39
Score: 4.22593 Sequence: AggTaCATtaAAaATaCcTGT
Locus tag: swp_3404
Name: nnrS2 Funciton: NnrS protein involved in response to NO
Locus tag: swp_3403
Name: nrfA Funciton: Nitrite reductase, cytochrome c(552) |
||||
| nnrS2-nrfA | -39 | 4.2 | AggTaCATtaAAaATaCcTGT | swp_3404 |
| Shewanella sp ANA-3 | ||||
|
Position: -46
Score: 4.52546 Sequence: AAGTGCAATTATTATGAAGCT
Locus tag: Shewana3_2362
Name: nnrS2 Funciton: NnrS protein involved in response to NO
Locus tag: Shewana3_2363
Name: nrfA Funciton: Nitrite reductase, cytochrome c(552) |
||||
| nnrS2-nrfA | -46 | 4.5 | AAGTGCAATTATTATGAAGCT | Shewana3_2362 |