Orthologous regulated operons containing Ssed_4367 gene

Properties
Regulog:	NsrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella sediminis HAW-EB3
Position: -169 Score: 5.0032 Sequence: ACATGCAAAATCAATACAGGT Locus tag: Ssed_4366 Name: Ssed_4366 Funciton: hydroxylamine oxidoreductase Locus tag: Ssed_4367 Name: Ssed_4367 Funciton: NapC/NirT cytochrome c domain protein
Ssed_4366-Ssed_4367	-169	5	ACATGCAAAATCAATACAGGT	Ssed_4366
Shewanella woodyi ATCC 51908
Position: -139 Score: 5.04606 Sequence: ACATGCGAAAAATATACAGGT Locus tag: Swoo_4755 Name: Ssed_4366 Funciton: hydroxylamine oxidoreductase Locus tag: Swoo_4756 Name: Ssed_4367 Funciton: NapC/NirT cytochrome c domain protein
Ssed_4366-Ssed_4367	-139	5	ACATGCGAAAAATATACAGGT	Swoo_4755

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --