Orthologous regulated operons containing yveF gene

Properties
Regulog:	PadR - Bacillales
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Phylum:	Firmicutes

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus subtilis subsp. subtilis str. 168
Position: -48 Score: 6.80956 Sequence: GAACATGTAAATAGTTACATGATT Locus tag: BSU34420 Name: yveF Funciton: Hypothetical protein Locus tag: BSU34410 Name: yveG Funciton: Hypothetical protein Locus tag: BSU34400 Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
yveF-yveG-padC	-48	6.8	GAACATGTAAATAGTTACATGATT	BSU34420

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --