Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fadD3 gene

Properties
Regulog: PsrA - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/gamma
Built upon 295 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella sediminis HAW-EB3
Position: -180
Score: 5.4703
Sequence: ATTAAAACGATCGTTTGCTT
Locus tag: Ssed_1667
Name: fadD3
Funciton: long-chain-fatty-acid--CoA ligase
fadD3 -180 5.5 ATTAAAACGATCGTTTGCTT Ssed_1667
© 2009-2020 RegPrecise