Orthologous regulated operons containing gltA gene
Regulog: | PsrA - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Fatty acid degradation |
Effector: | Oleate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Sama_1422
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Sama_1422 |
Shewanella baltica OS155 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Sbal_2520
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Sbal_2520 |
Shewanella denitrificans OS217 | ||||
Position: -50
Score: 5.57696 Sequence: AATTAAACGCTTATTTAAAT
Locus tag: Sden_2189
Name: gltA Funciton: citrate synthase |
||||
gltA | -50 | 5.6 | AATTAAACGCTTATTTAAAT | Sden_2189 |
Shewanella frigidimarina NCIMB 400 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Sfri_2348
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Sfri_2348 |
Shewanella halifaxensis HAW-EB4 | ||||
Position: -101
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Shal_2494
Name: gltA Funciton: citrate synthase |
||||
gltA | -101 | 5.7 | ATTTAAACGCTTATTTAAAT | Shal_2494 |
Shewanella loihica PV-4 | ||||
Position: -103
Score: 5.76654 Sequence: ATTTAAACACTTATTTAAAT
Locus tag: Shew_1650
Name: gltA Funciton: citrate synthase |
||||
gltA | -103 | 5.8 | ATTTAAACACTTATTTAAAT | Shew_1650 |
Shewanella oneidensis MR-1 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: SO_1926
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | SO_1926 |
Shewanella pealeana ATCC 700345 | ||||
Position: -101
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Spea_1783
Name: gltA Funciton: citrate synthase |
||||
gltA | -101 | 5.7 | ATTTAAACGCTTATTTAAAT | Spea_1783 |
Shewanella piezotolerans WP3 | ||||
Position: -101
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: swp_2957
Name: gltA Funciton: citrate synthase |
||||
gltA | -101 | 5.7 | ATTTAAACGCTTATTTAAAT | swp_2957 |
Shewanella putrefaciens CN-32 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Sputcn32_2274
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Sputcn32_2274 |
Shewanella sediminis HAW-EB3 | ||||
Position: -100
Score: 5.76654 Sequence: ATTTAAACACTTATTTAAAT
Locus tag: Ssed_2819
Name: gltA Funciton: citrate synthase |
||||
gltA | -100 | 5.8 | ATTTAAACACTTATTTAAAT | Ssed_2819 |
Shewanella sp ANA-3 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Shewana3_1705
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Shewana3_1705 |
Shewanella sp MR-4 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Shewmr4_1630
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Shewmr4_1630 |
Shewanella sp MR-7 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Shewmr7_1705
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Shewmr7_1705 |
Shewanella sp W3-18-1 | ||||
Position: -105
Score: 5.71894 Sequence: ATTTAAACGCTTATTTAAAT
Locus tag: Sputw3181_1734
Name: gltA Funciton: citrate synthase |
||||
gltA | -105 | 5.7 | ATTTAAACGCTTATTTAAAT | Sputw3181_1734 |
Shewanella woodyi ATCC 51908 | ||||
Position: -100
Score: 5.73778 Sequence: ATTTAAACGGTTATTTAAAT
Locus tag: Swoo_1832
Name: gltA Funciton: citrate synthase |
||||
gltA | -100 | 5.7 | ATTTAAACGGTTATTTAAAT | Swoo_1832 |