Orthologous regulated operons containing omp1 gene
Regulog: | TyrR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TyrR |
Regulation mode: | activator |
Biological process: | Amino acid utilization |
Effector: | Tyrosine; Phenylalanine |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -326
Score: 4.79201 Sequence: GTGTAACTACATATTTACAA
Locus tag: Sama_2026
Name: omp1 Funciton: TonB-dependent receptor
Locus tag: Sama_2025
Name: pep4 Funciton: prolyl oligopeptidase family protein |
||||
omp1-pep4 | -326 | 4.8 | GTGTAACTACATATTTACAA | Sama_2026 |