Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pep2 gene

Properties
Regulog: TyrR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator
Biological process: Amino acid utilization
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Built upon 312 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -140
Score: 4.58662
Sequence: GTGTAACTCATATGTTACAC
Locus tag: Sama_1201
Name: pep2
Funciton: peptidase M4 thermolysin
pep2 -140 4.6 GTGTAACTCATATGTTACAC Sama_1201