Orthologous regulated operons containing pepD gene
| Regulog: | TyrR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator |
| Biological process: | Amino acid utilization |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella amazonensis SB2B | ||||
|
Position: -123
Score: 4.36728 Sequence: CTGGAAACTTTGGCTTCCAC
Locus tag: Sama_2519
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -123 | 4.4 | CTGGAAACTTTGGCTTCCAC | Sama_2519 |
| Shewanella baltica OS155 | ||||
|
Position: -123
Score: 4.00814 Sequence: CTGGAAACTTTGGCTGCCAG
Locus tag: Sbal_0940
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -123 | 4 | CTGGAAACTTTGGCTGCCAG | Sbal_0940 |
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -160
Score: 4.58306 Sequence: GTGGAAACTTTGCCTGACAA
Locus tag: Shal_3175
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -160 | 4.6 | GTGGAAACTTTGCCTGACAA | Shal_3175 |
| Shewanella loihica PV-4 | ||||
|
Position: -123
Score: 4.5857 Sequence: GTGGCAACTTAGTATGACAC
Locus tag: Shew_2852
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -123 | 4.6 | GTGGCAACTTAGTATGACAC | Shew_2852 |
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -141
Score: 4.50367 Sequence: GTGGAAACTTTGGCTGACAA
Locus tag: Spea_3091
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -141 | 4.5 | GTGGAAACTTTGGCTGACAA | Spea_3091 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -140
Score: 4.01319 Sequence: ATGGCAACTTCTGCTGACAC
Locus tag: swp_1180
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -140 | 4 | ATGGCAACTTCTGCTGACAC | swp_1180 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -108
Score: 3.87028 Sequence: CTGGCAACTTTGGCTGCCAG
Locus tag: Sputcn32_0954
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -108 | 3.9 | CTGGCAACTTTGGCTGCCAG | Sputcn32_0954 |
| Shewanella sp W3-18-1 | ||||
|
Position: -108
Score: 3.87028 Sequence: CTGGCAACTTTGGCTGCCAG
Locus tag: Sputw3181_3222
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -108 | 3.9 | CTGGCAACTTTGGCTGCCAG | Sputw3181_3222 |
| Shewanella woodyi ATCC 51908 | ||||
|
Position: -180
Score: 3.83475 Sequence: TTGGCAACTTTCAATGACAG
Locus tag: Swoo_3603
Name: pepD Funciton: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3) |
||||
| pepD | -180 | 3.8 | TTGGCAACTTTCAATGACAG | Swoo_3603 |