Orthologous regulated operons containing pep3 gene
Regulog: | TyrR - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TyrR |
Regulation mode: | activator |
Biological process: | Amino acid utilization |
Effector: | Tyrosine; Phenylalanine |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella baltica OS155 | ||||
Position: -173
Score: 3.99379 Sequence: CTGGTAACCTTTAGTTACAT
Locus tag: Sbal_0685
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -173 | 4 | CTGGTAACCTTTAGTTACAT | Sbal_0685 |
Shewanella denitrificans OS217 | ||||
Position: -224
Score: 3.78381 Sequence: TTGGTTACATAAATTGCCAG
Locus tag: Sden_1089
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -224 | 3.8 | TTGGTTACATAAATTGCCAG | Sden_1089 |
Shewanella halifaxensis HAW-EB4 | ||||
Position: -202
Score: 3.85714 Sequence: TAGGAAACCTTTTCTTACAC
Locus tag: Shal_3258
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -202 | 3.9 | TAGGAAACCTTTTCTTACAC | Shal_3258 |
Shewanella loihica PV-4 | ||||
Position: -180
Score: 4.11541 Sequence: GAGGAAATCTTTACTTACAT
Locus tag: Shew_2973
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -180 | 4.1 | GAGGAAATCTTTACTTACAT | Shew_2973 |
Shewanella oneidensis MR-1 | ||||
Position: -173
Score: 4.18411 Sequence: ATGGTAATTTTTAGTTACAA
Locus tag: SO_3844
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -173 | 4.2 | ATGGTAATTTTTAGTTACAA | SO_3844 |
Shewanella pealeana ATCC 700345 | ||||
Position: -237
Score: 3.76572 Sequence: TGGGAAACCTTTTCTTACAC
Locus tag: Spea_3177
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -237 | 3.8 | TGGGAAACCTTTTCTTACAC | Spea_3177 |
Shewanella piezotolerans WP3 | ||||
Position: -189
Score: 3.85714 Sequence: TAGGAAACCTTTTCTTACAC
Locus tag: swp_3866
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -189 | 3.9 | TAGGAAACCTTTTCTTACAC | swp_3866 |
Shewanella putrefaciens CN-32 | ||||
Position: -276
Score: 3.6298 Sequence: ATGTTAAGTTTATTTGCCTT
Locus tag: Sputcn32_0791
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -276 | 3.6 | ATGTTAAGTTTATTTGCCTT | Sputcn32_0791 |
Shewanella sediminis HAW-EB3 | ||||
Position: -218
Score: 4.03602 Sequence: AAGGAAACCTTTACTTACAC
Locus tag: Ssed_3509
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -218 | 4 | AAGGAAACCTTTACTTACAC | Ssed_3509 |
Shewanella sp ANA-3 | ||||
Position: -172
Score: 4.18411 Sequence: ATGGTAATTTTTAGTTACAA
Locus tag: Shewana3_0759
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -172 | 4.2 | ATGGTAATTTTTAGTTACAA | Shewana3_0759 |
Shewanella sp MR-4 | ||||
Position: -173
Score: 4.18411 Sequence: ATGGTAATTTTTAGTTACAA
Locus tag: Shewmr4_3179
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -173 | 4.2 | ATGGTAATTTTTAGTTACAA | Shewmr4_3179 |
Shewanella sp MR-7 | ||||
Position: -172
Score: 4.18411 Sequence: ATGGTAATTTTTAGTTACAA
Locus tag: Shewmr7_0787
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -172 | 4.2 | ATGGTAATTTTTAGTTACAA | Shewmr7_0787 |
Shewanella sp W3-18-1 | ||||
Position: -276
Score: 3.6298 Sequence: ATGTTAAGTTTATTTGCCTT
Locus tag: Sputw3181_3384
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -276 | 3.6 | ATGTTAAGTTTATTTGCCTT | Sputw3181_3384 |
Shewanella woodyi ATCC 51908 | ||||
Position: -178
Score: 3.71963 Sequence: AAGGAAACCTTTTCTTACAT
Locus tag: Swoo_0911
Name: pep3 Funciton: peptidase, M13 family |
||||
pep3 | -178 | 3.7 | AAGGAAACCTTTTCTTACAT | Swoo_0911 |