Orthologous regulated operons containing tyrR gene
| Regulog: | TyrR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator |
| Biological process: | Amino acid utilization |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella amazonensis SB2B | ||||
|
Position: -134
Score: 4.6379 Sequence: CTGTAAACAAGACTTGCCAC
Locus tag: Sama_2220
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -134 | 4.6 | CTGTAAACAAGACTTGCCAC | Sama_2220 |
| Shewanella baltica OS155 | ||||
|
Position: -196
Score: 4.70177 Sequence: CTGTAAACTAGGCTTGCCAC
Locus tag: Sbal_1486
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -196 | 4.7 | CTGTAAACTAGGCTTGCCAC | Sbal_1486 |
| Shewanella denitrificans OS217 | ||||
|
Position: -155
Score: 4.6379 Sequence: CTGTAAACAAGACTTGCCAC
Locus tag: Sden_2593
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -155 | 4.6 | CTGTAAACAAGACTTGCCAC | Sden_2593 |
| Shewanella frigidimarina NCIMB 400 | ||||
|
Position: -92
Score: 4.66499 Sequence: CTGTAAACTTCACTTGCCAC
Locus tag: Sfri_1330
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -92 | 4.7 | CTGTAAACTTCACTTGCCAC | Sfri_1330 |
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -159
Score: 4.09066 Sequence: CTGTAAACAAGCCTTGCCAC
Locus tag: Shal_1533
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -159 | 4.1 | CTGTAAACAAGCCTTGCCAC | Shal_1533 |
| Shewanella loihica PV-4 | ||||
|
Position: -162
Score: 4.70133 Sequence: GTGTAAACAACTCTTGCCAC
Locus tag: Shew_1437
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -162 | 4.7 | GTGTAAACAACTCTTGCCAC | Shew_1437 |
| Shewanella oneidensis MR-1 | ||||
|
Position: -190
Score: 4.70177 Sequence: CTGTAAACTAGGCTTGCCAC
Locus tag: SO_1669
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -190 | 4.7 | CTGTAAACTAGGCTTGCCAC | SO_1669 |
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -158
Score: 4.57895 Sequence: CTGTAAACAAGTCTTGCCAC
Locus tag: Spea_1450
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -158 | 4.6 | CTGTAAACAAGTCTTGCCAC | Spea_1450 |
| Shewanella piezotolerans WP3 | ||||
|
Position: -309
Score: 4.57895 Sequence: cTGTAAAcaagtCTTgcCAC
Locus tag: swp_1652
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -309 | 4.6 | cTGTAAAcaagtCTTgcCAC | swp_1652 |
| Shewanella putrefaciens CN-32 | ||||
|
Position: -188
Score: 4.76388 Sequence: CTGTAAACTTGACTTGCCAC
Locus tag: Sputcn32_1388
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -188 | 4.8 | CTGTAAACTTGACTTGCCAC | Sputcn32_1388 |
| Shewanella sediminis HAW-EB3 | ||||
|
Position: -151
Score: 4.6379 Sequence: CTGTAAACAAGACTTGCCAC
Locus tag: Ssed_2928
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -151 | 4.6 | CTGTAAACAAGACTTGCCAC | Ssed_2928 |
| Shewanella sp ANA-3 | ||||
|
Position: -205
Score: 4.69685 Sequence: CTGTAAACTAGACTTGCCAC
Locus tag: Shewana3_2779
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -205 | 4.7 | CTGTAAACTAGACTTGCCAC | Shewana3_2779 |
| Shewanella sp MR-4 | ||||
|
Position: -205
Score: 4.69685 Sequence: CTGTAAACTAGACTTGCCAC
Locus tag: Shewmr4_2605
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -205 | 4.7 | CTGTAAACTAGACTTGCCAC | Shewmr4_2605 |
| Shewanella sp MR-7 | ||||
|
Position: -205
Score: 4.69685 Sequence: CTGTAAACTAGACTTGCCAC
Locus tag: Shewmr7_2672
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -205 | 4.7 | CTGTAAACTAGACTTGCCAC | Shewmr7_2672 |
| Shewanella sp W3-18-1 | ||||
|
Position: -188
Score: 4.76388 Sequence: CTGTAAACTTGACTTGCCAC
Locus tag: Sputw3181_2713
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -188 | 4.8 | CTGTAAACTTGACTTGCCAC | Sputw3181_2713 |
| Shewanella woodyi ATCC 51908 | ||||
|
Position: -161
Score: 4.6379 Sequence: CTGTAAACAAGACTTGCCAC
Locus tag: Swoo_1717
Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis |
||||
| tyrR | -161 | 4.6 | CTGTAAACAAGACTTGCCAC | Swoo_1717 |