Orthologous regulated operons containing BH0738 gene
| Regulog: | YybR/YdeP - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus halodurans C-125 | ||||
|
Position: -101
Score: 5.16591 Sequence: TAGTAACCTACATGTAACTA
Locus tag: BH0738
Name: BH0738 Funciton: Zinc-containing alcohol dehydrogenase / Quinone oxidoreductase ( NADPH:quinone reductase) |
||||
| BH0738 | -101 | 5.2 | TAGTAACCTACATGTAACTA | BH0738 |